• 专利附录
  • 专利说明
  • 权利要求
  • 类似技术
  • 同族专利
  • 引用文献
  • 法律状态
  • 优先权
    • 专利摘要:
    Biosensor for the detection of nucleic acids, method of preparation and use. The present invention relates to a biosensor for detecting nucleic acids, especially short-chain ones, without the need for resorting to amplification reactions. It comprises, on the one hand, ascending conversion nanoparticles (ucnp) covered by a layer of sio2, or other materials, and functionalized by the binding of single-stranded nucleic acid and, on the other hand, a buffer capable of extinguish the fluorescence of a fluorophore. Due to its characteristics, the biosensor of the invention can be used to detect nucleic acids in environmental, plant, animal and human samples, in order to detect microorganisms, diseases or alterations or to analyze the presence of animal and/or plant species in foods. The invention also relates to a method for making the biosensor, to a method for using it and to a kit containing it. (Machine-translation by Google Translate, not legally binding)
    公开号:ES2580138A1
    申请号:ES201600412
    申请日:2016-05-24
    公开日:2017-05-09
    发明作者:Enrique José LÓPEZ CABARCOS；Diego MÉNDEZ GONZÁLEZ；Marco LAURENTI；Paulino ALONSO CRISTÓBAL；Jorge Rubio Retama
    申请人:Universidad Complutense de Madrid；
    IPC主号:
    专利说明:

    induces the separation between the donor and the acceptor and, therefore, the donor fluorescence increases proportionally to the concentration of the target nucleic acid.
    The detection of nucleic acids using these assays is often based on a self-complementary sequence within a hairpin that creates intimate contact between the buffer and the fluorescent marker. By adding the complementary chain, hybridization results in the separation of the fluorophore from the buffer and fluorescence can be detected. Other assays can detect the activity of DNase enzymes, which can selectively identify and cut specific sequences of DNA, thus separating the fluorophore from the buffer and restoring fluorescence. Although there are many strategies for designing DNA-based sensors, the sensitivity of detection is determined by fluorophores. The organic markers used often suffer from photobleaching problems, while inorganic quantum dots have flickering effects. Even so, the main disadvantage they present is the excitation wavelength of fluorophores, which is normally located in the UV-visible region, and which produces background fluorescence due to biomolecules as well as internal filter caused by the absorption of other species, which limit the sensitivity of detection.
    Sensors and devices are described in the state of the art with which the limits of detection of nucleic acids have been reduced. Thus, in Luo, M. and col. (2012). Chem. Commun. 48: 1126-1128. "Chemiluminescence biosensors for DNA detection using graphene oxide and a horseradish peroxidase-mimicking DNAzyme", describes a DNA detection platform that mimics the ONAzyme system using graphene oxide (GO) and horseradish peroxidase, using chemiluminescence. Detection limits of 34pM are reached.
    In Zhao, XH. et al. (2012). Analytica Chimica Acta, 727: 67-70. "Graphene oxide-based biosensor for sensitive fluorescence detection of DNA based on exonuclease III-aided signal amplification", and also based on the buffering capacity of the GO fluorescence, an enzymatic amplification is used with which limits of 20 pM are reached .
    Alonso-Cristobal, P. et al. (2015) Appl. Mater. Interfaces, 7: 12422-12429. "Highly sensitive DNA sensor based on upconversion nanoparticles and graphene oxide" describe a biosensor based on fluorescence resonance energy transfer (FRET) between nanoparticles, doped with elements of the lanthanide group, and GO. In this case, a detection limit of 5 pM is described.
    On the other hand, the document by Dong, H. et al. (2012). Analytical Chemistry, 84: 4587-4593. "Highly sensitive multiple microRNA detection based on fluorescence quenching of graphene oxide and isothermal stranddisplacement polymerase reaction" describes a method to detect microRNA with femtomolar detection limits by means of amplifying the sample RNA by means of isothermal strand-displacement polymerase reaction, a method that It is applied in other documents, such as CN102703594, where the detection limit is also reduced.
    Another possibility described in the state of the art is the functionalization of nanoparticles with APN (peptide nucleic acid) which, in the case of US2015080251, also leads to femtomolar detection limits.
    The detection of RNA and DNA chains in a sample provides valuable information and has commercial and research applications such as biomedical diagnostics, drug screening, monitoring of environmental pollutants, food safety assessment, as well as applications in the discovery of new principles. assets. It is of interest, therefore, to obtain biosensors to determine the presence of nucleic acids with high sensitivity and specificity and through a rapid and reproducible methodology. Detailed description of the invention
    Biosensor for the detection of nucleic acids, method of elaboration and use.
    One aspect of the present invention relates to a biosensor for the detection of nucleic acids based on a special type of luminescent nanoparticles, capable of transforming infrared light into visible light or
    ultraviolet, which are called upstream nanoparticles
    (UCNP, from the English upconversion nanoparticles). It's about materials
    inorganic doped with lanthanide elements that are capable of absorbing
    2 or more low energy photons and emit fluorescence at a wavelength
    5 shorter than excitation.
    DNA biosensors based on energy transfer by
    fluorescence resonance (FRET) between nanoparticles doped with Yb and
    Er and graphene oxide (GO) (Alonso-Cristobal, P. et al. (2015) Appl. Mater.
    the Interfaces, 7: 12422-12429. "Highly sensitive DNA sensor based on
    upconversion nanoparticles and graphene oxide "). In these biosensors,
    added a coating of Si02 (UCNP @ Si02) to the nanoparticles to
    facilitate the binding of single-stranded DNA that constitutes the sensor probe
    (UCNP @ Si02-ssDNA, from the English single strand ONA). This way when
    fifteen the nanoparticles functionalized with DNA are close to the surface
    of GO, FRET fluorescence damping is induced due to the
    superposition of the fluorescence emission of the nanoparticle and the spectrum
    GO absorption. However, in the presence of DNA chains
    complementary to the probe, hybridization of these with the DNA strands
    twenty of the UCNP @ Si02-ssDNA nanoparticles gives rise to double stranded DNA that
    does not interact with the GO surface, which implies that nanoparticles
    They maintain their fluorescence. As described in the scientific article,
    these biosensors are able to detect 5 pM of DNA and they get it
    by a procedure that does not require amplification reactions.
    25
    Surprisingly, when the acid detection procedure
    single-stranded nuclei from a sample was performed with a
    biosensor as described in Alonso-Cristobal, P. et al. (2015) in which the
    Nanoparticle concentration UCNP @ Si02-ssDNA had decreased from
    30 0.4 mg / ml (concentration used in the sensor described in the article
    cited scientist) at concentrations of 0.01-0.1 mg / ml, the limit of detection
    of the sensor decreased to 1 fM.
    One aspect of the invention, therefore, relates to a biosensor for the
    35 nucleic acid detection comprising:
    -a nanoparticulate system that includes a matrix with an acceptor
    selected from the lanthanide group and a selected donor from the
    group of lanthanides, and a layer with COOH functional groups that allows the binding of a detection probe; - a buffer, understood as such a compound capable of damping the fluorescence of a fluorophore; -a detection probe; in which the concentration of the nanoparticulate system, once mixed all the elements that integrate it as well as the sample problem in which it is intended to identify the presence or absence of the nucleic acid for whose detection the biosensor is designed, is 0.01- 0.1 mg / ml aqueous solution.
    The biosensor of the invention is especially indicated for detecting short chains of nucleic acids. Here, short chains of nucleic acids are understood as those chains of DNA, RNA or other nucleic acids having between 15 and 50 nucleotides.
    The nanoparticulate system may consist of nanofibers, nanowires, nanollamines, nanoparticles or any other arrangement on a nanometric scale. Throughout this specification, the term nanoparticle is used to encompass any of the provisions that a nanoparticulate system may adopt.
    With the term matrix, in this report we refer to the set of elements that form the nanoparticle and that are based on NaYF4, CaYF5, CaF2, and other sets of elements that perform the same function.
    For its part, the donor, that is, the ion that is responsible for absorbing low-energy photons in the near infrared and yielding the quanta of energy to the acceptor, can be Yb3 +, Gd3 +, Nd3 +, Ce3 +, or combinations thereof and , preferably, Yb3 + is selected. The donor concentration can vary between 10 and 95 mol% with respect to the total acceptor and donor, that is, with respect to the sum of the concentration of the acceptor and the concentration of the donor, being one of the preferred concentrations of 90 mol% .
    The acceptor, that is, the ion that absorbs the energy quanta from the donor, is preferably selected from the group consisting of Tm3 +, Er3 +, Dy3 +, Sm3 +, H03 +, Eu3 +, Tb3 + and Pr3 + or combinations thereof, and among them, Er3 +, Tm3 + or combinations of the two are preferably selected, with Er3 + being the most preferred acceptor. The concentration of the acceptor can vary between 5 and 90 mol% with respect to the total acceptor and donor, being of choice in concentrations of 10 mol%.
    In addition, the nanoparticles are coated with a layer that allows the detection probe to be anchored since it incorporates COOH functional groups. These layers include those formed by silicon oxide (Si02), acrylic polyacid (PAA), azelaic acid or phosphonic acid derivatives.
    The buffer is selected from those that have a high efficiency, such as: graphene oxide, monolayer or multilayer carbon nanotubes, nanolamines or nanoparticles of carbon nitride, soot, or graphite nanoparticles or combinations thereof, being of choice graphene oxide The preferred concentration of graphene oxide is 0.05-0.3 mg / ml, in aqueous solution, once all the biosensor elements are incorporated and the test sample, that is, the sample in which it is desired to find out if there is , or not, the target nucleic acid for whose detection the biosensor has been designed.
    As for the detection probe, it can be selected from the group consisting of: antibodies, peptides, enzymes, cells, DNA, RNA, ALN, APN, their derivatives, cooligomers and combinations thereof. Preferably, DNA, RNA, ALN, APN or its derivatives are selected and, among them, especially DNA, the single-stranded DNA being of choice. The surface binding of the nanoparticles can be covalent or non-covalent, although the bond is preferably covalent.
    The nanoparticulate system can be a simple structure nanoparticle such as those based on NaYF4: Yb, Er @ Si02, NaYF4: Yb, Er @ (acrylic polyacid), NaYF4: Yb, Er @ (azelaic), NaYF4: Yb, Er @ ( phosphonic), NaYF4: Yb, Er @ NaY @ Si02, NaYF4: Yb, Er @ NaY @ (acrylic polyacid), NaYF4: Yb, Er @ NaY @ (azelaic), NaYF4: Yb, Er @ NaY @ (azelaic) or NaYF4: Yb, Er @ NaY @ (polyacrylic acid).
    On the other hand, the concentration of nanoparticles of the biosensor in aqueous solution may be between 0.01 and 0.1 mg / ml and, preferably,
    Its concentration is 0.01 mg / ml. This concentration of nanoparticles isrefers to what is achieved after incorporating all the elements that make up thebiosensor and also the problem sample.
    A second aspect of the invention relates to a method of making thebiosensors of the invention which includes preparing two suspensions (A and B)where the preparation of suspension A comprises the following steps:a) synthesize a nanoparticulate system that includes a matrix with aacceptor and a donor;b) coat the nanoparticulate system from step a) with a layer with groupsCOOH functional;c) functionalize the nanoparticulate system in step b) by joininga detection probe;d) prepare a suspension in aqueous solution that includesfunctionalized nanoparticles of step c);and the preparation of the suspension B comprises the step:e) prepare a suspension of buffer in aqueous solution, understandingby a buffer a compound capable of damping the fluorescence of afluorophore;such that, once the solution A is mixed with the suspension B and withA problem sample, the concentration of functionalized nanoparticles0.01-0.1 mg / ml and preferably 0.01 mg / ml.
    The nanoparticulate system of step a) may be constituted bynanofibers, nanowires, nanollamines, nanoparticles or any othernanometric scale layout. The matrix it includes is based onNaYF4, CaYFs, CaF2, or other sets of elements that perform the samefunction. The donor can be Yb3 +, Gd3 +, Nd3 +, Ce3 +, or combinations of thethemselves and, preferably, Yb3 + is selected. The concentration at whichincludes the donor can vary between 10 and 95 mol% with respect to the total ofacceptor and donor, being one of the preferred concentrations of 90mol% On the other hand, the acceptor is preferably selected from the groupformed by Tm3 +, Er3 +, Dy3 +, Sm3 +, H03 +, Eu3 +, Tb3 + and Pr3 + or combinationsof these and, among them, preferably Er3 +, Tm3 + orcombinations of the two, with Er3 + being the most preferred acceptor. TheAcceptor concentration may vary between 5 and 90 mol% with respect to
    total acceptor and donor, being of choice in concentrations of 10 mol%.
    The material used in step b) is selected from the group consisting of: silicon oxide (Si02), acrylic polyacid (PAA), azelaic acid and / or phosphonic acid derivatives.
    The nanoparticulate system from step a) is selected from the group: NaYF 4: Yb, Er @ Si02, NaYF4: Yb, Er @ (acrylic polyacid), NaYF4: Yb, Er @ (azelaic), NaYF4: Yb, Er @ (phosphonic ), NaYF4: Yb, Er @ NaY @ Si02, NaYF4: Yb, Er @ NaY @ (acrylic polyacid), NaYF4: Yb, Er @ NaY @ (azelaic), NaYF4: Yb, Er @ NaY @ (azelaic), NaYF4 : Yb, Er @ NaY @ (polyacrylic acid).
    The detection probe used in step c) to functionalize the nanoparticulate system can be selected from the group consisting of: antibodies, peptides, enzymes, cells, DNA, RNA, ALN, APN, their derivatives, cooligomers and combinations thereof. Preferably, a natural or artificial single stranded nucleic acid, or its derivatives, and especially DNA, is selected. The surface binding of the nanoparticles can be covalent or non-covalent, although the bond is preferably covalent.
    The suspension buffer B is selected from those that have a high efficiency, such as: graphene oxide, monolayer or multilayer carbon nanotubes, nanolamines or nanoparticles of carbon nitride, soot, or graphite nanoparticles or combinations thereof , graphene oxide being of choice. The suspension is prepared in such a way that, once the suspension A is mixed with the suspension B and with the test sample, the buffer concentration is 0.05-0.3 mg / ml.
    A third aspect of the invention relates to a method for detecting a target nucleic acid sequence present in a test sample that includes:
    (1) incubate the test sample with functionalized nanoparticles by joining a detection probe, in aqueous medium, at the appropriate temperature and for the time necessary for the denaturation of the double nucleic acid chains present in the mixture and subsequently, at the appropriate temperature and for the time necessary to hybridize the detection probe attached to the nanoparticles and the complementary nucleic acid whose presence / absence is to be determined in the test sample;
    (2) decrease the temperature of the mixture from step a) until it reaches room temperature;
    (3) add a buffer in aqueous solution and incubate at room temperature for at least 10 minutes;
    (4) measure the emitted fluorescence;
    (5) select as positive samples whose fluorescence is at least three times greater than that emitted by a negative control; where the concentration of nanoparticles in step (3) is 0.01-0.1 mg / ml of aqueous solution and the negative control is the signal generated by the biosensor in the absence of complementary nucleic acid to the detection probe.
    In this way, the one whose signal is at least three times higher than the signal obtained from the negative control is established as a positive sample. On the contrary, it is defined as a negative sample whose signal is equal
    or less than three times the negative control signal.
    Step (1) is performed by raising the temperature of the mixture above the denaturation temperature of the nucleic acid which, in any case, can be 85-95 ° C. It is kept at this temperature for 3-10 minutes, preferably 5 minutes, and then allowed to warm to 40-45 OC), temperature at which it is maintained for a minimum time of 15 min .; after that time it is tempered to 20-30 ° C.
    The suspension of buffer in aqueous solution of step (3) is added so that the final concentration of the buffer in the mixture is 0.050.3 mg / mL and incubated at a temperature of 20-30 ° C for at least 10 minutes.
    In addition, the concentration of nanoparticles in step (3) is preferably 0.01 mg / ml.
    In this method of detection, the problem sample can come from any type of origin, such as: soil, water, vegetables, food, blood, urine, cerebrospinal fluid, mucous membranes, biopsies, saliva, biological specimens or body fluids. In any case, samples whose origin is animals or man are isolated from them, and the detection of the corresponding nucleic acid is performed in vitro.
    The invention also relates to a kit that includes a biosensor with the technical characteristics described herein. In addition, the kit may include those reagents and solutions that are necessary for the detection of nucleic acids and, especially, of short chain nucleic acids, short chain nucleic acids being understood as those having between 15 and 50 nucleotides.
    The sample in which it is desired to detect the presence or absence of the target nucleic acid can come from soil, water, vegetables, food, blood, urine, cerebrospinal fluid, mucous membranes, biopsies, saliva, biological specimens and body fluids and the objective of detecting the target sequence in any of them can be the detection of infectious or non-infectious diseases, pathogenic microorganisms, genetic alterations, cancer, RNA, DNA, proteins, peptides, antibodies, prenatal screening; as well as the detection of possible food fraud, allergens, certain proteins, animal and / or plant species in food.
    The invention also relates to the in vitro use of the biosensor or kit of the invention in the detection of infectious or non-infectious diseases, pathogenic microorganisms, genetic alterations, cancer, RNA, DNA, proteins, peptides, antibodies, prenatal screening; and to the use of the biosensor or kit of the invention in the detection of allergens, certain proteins, animal and / or plant species in foods.
    Among the infectious or non-infectious diseases that can be detected with the method, the kit and / or the biosensor of the invention, stand out AIDS and dengue.
    The increased sensitivity provided by the biosensor of the invention with respect to the state of the art allows the use of nanoparticles as molecular beacons to detect amounts of RNA and / or DNA so small that it is not necessary to resort to amplification reactions of the Nucleic acids in the sample, that is, biological concentrations of the nucleic acids can be detected which facilitates, shortens and lowers the
    5 procedures regarding what is known so far.
    Brief description of the figures Figure 1. (A) Micrograph by transmission electron microscope (TEM) of NaYF4 monodisperse nanoparticles: Yb, Er.
    10 TEM micrograph of monodispersed and individually coated nanoparticles: (B) NaYF4: Yb, Er @ Si02, (C) NaYF4: Yb, Er @ PAA, (O) NaYF4: Yb, Er @ azelaico. The scale bars represent 50 nm.
    Figure 2. Fluorescence spectrum of upstream conversion of UCNPs-ssDNA nanoparticles; concentrations: 0.4 mg / mL (solid line), 0.04 mg / mL (dashed line) and 0.01 mg / mL (dotted line). The normalized fluorescence intensity (PL) is represented against the wavelength, t ...
    20 Figure 3. Representation of the normalized fluorescence intensity (PL) of different concentrations of UCNPs-ssDNA nanoparticles: 0.4 mg / mL (solid squares), 0.04 mg / mL (empty circles) and 0.01 mg / mL (solid circles), in the presence of different concentrations of GO in mg / mL.
    25 Figure 4. (A) Representation of the normalized fluorescence intensity (PL) of different concentrations of UCNPs-ssDNA nanoparticles: 0.4 mg / mL (solid squares), 0.1 mg / mL (solid triangles), 0, 04 mg / mL (empty circles) and 0.01 mg / mL (solid circles), in the presence of different concentrations in molarity (M) of Dengue virus type 11 RNA
    30 complementary to the nanoparticle detection probe, and in the presence of 0.1 mg / mL of GO. (B) Extension of the calibration curve to low concentrations of RNA of Dengue virus type 11.
    Figure 5. Representation of the fluorescence intensity (PL) of UCNPs-ssDNA at a concentration of 0.01 mg / mL in the presence of non-complementary RNA at a concentration of 1 nM.
    EMBODIMENT OF THE INVENTION The present invention is further illustrated by the following examples, which are not intended to limit its scope.
    5 Example 1. Synthesis of NaYF4 monodisperse nanoparticles: Yb, Er. In a round bottom flask with three mouths, yttrium chloride was dissolved
    (111) hexahydrate (236.62 mg, 0.78 mmol), ytterbium chloride (111) hexahydrate (77.5 mg, 0.20 mmol) and erbium chloride (111) hexahydrate (7.63 mg, 0, 02 mmol) in oleic acid (6 mL, 19 mmol) and 1-octadecene (15 mL, 46.9 mmol); It was heated at 160 ° C for 1.5 hours under a nitrogen atmosphere. After this time, a solution of sodium hydroxide (100 mg, 2.5 mmol) and ammonium fluoride (148.16 mg, 4 mmol) dissolved in 10 ml of methanol was added dropwise to the reaction. strong agitation The mixture was slowly heated to 100 ° C and kept 2 hours under a nitrogen atmosphere and 30 minutes under vacuum. Subsequently, the flask with the mixture was connected with a thermometer and a reflux condenser, subjected to a nitrogen atmosphere and placed in a heating jacket. The temperature was raised to 300 ° C and maintained for 1.5 hours; it was allowed to cool to room temperature; and the NaYF4: Yb, Er nanoparticles were recovered by centrifugation (8500 rpm, 10 min) with a mixture of hexane, ethanol and water (2: 1: 1 v / v). The sediment was resuspended in 5 ml of ethanol and centrifuged in a mixture of ethanol and water (1: 1 v / v). This procedure was repeated three times. Finally, the NaYF4: Yb, Er nanoparticles were resuspended and stored in hexane. The analysis of elements of
    25 synthesized nanoparticles confirmed that the exact composition was adjusted
    a: NaY79.18F4: Yb18.91, Er1.91. Figure 1A shows an image of the UCNP nanoparticles obtained by this synthesis. Figure 2 shows the fluorescence emission of synthesized nanoparticles at concentrations of 0.4 mg / mL (solid line), 0.04 mg / mL (dashed line) and
    30 0.01 mg / mL (dotted line) after being irradiated with a laser source at 980 nm.
    Example 2. Synthesis of NaYF4 nanoparticles: Yb, Er @ Si02.The UCNPs synthesized according to Example 1 were coated with silica by
    The alkaline catalysis polymerization of TEOS (tetraethyl orthosilicate) in a reverse emulsion. For this, in an ultrasonic bath, 240 mg of IGEPAL CO-520 (polyoxyethylene (5) nonylphenylether) and 5 mL of a hexane solution were mixed with the UCNP obtained in Example 1 (2 mg / mL). A solution of ammonium hydroxide (40 JI, 30%) was then added and mixed gently. The solution became completely transparent, indicating the formation of a microemulsion. To start the reaction, TEOS (30 JL, 0.14 mmol) was added under stirring and allowed to react overnight at room temperature. The reaction ended when the microemulsion was destabilized with 5 ml of methane! NaYF4: Yb, Er @ Si02 nanoparticles (UCNPs @ Si02) were purified with ethanol by centrifugation (3 x 8500 rpm, 10 min). Figure 1 B shows a TEM image of the UCNPs @ Si02 nanoparticles in which the size of the nanoparticles can be seen.
    Example 3. Modification of the surface of the NaYF4 nanoparticles: Yb, Er @ Si02 (UCNPs @ Si02). NaYF4: Yb, Er @ Si02 nanoparticles functionalized with carboxylic acid (UCNPs @ Si02-COOH) were prepared by successive steps. First, the surface of the nanoparticles obtained according to Example 2 was functionalized with amino groups by the addition of APTES (3-aminopropyl triethoxysilane, 150 JL, 0.68 mmol) to the UCNPs @ Si02 nanoparticles of Example 2 and dissolved in 5 ml of ethanol; The mixture was kept under stirring at room temperature overnight. Once the UCNPs @ Si02-NH2 nanoparticles were obtained, they were centrifuged 3 times and dispersed in 5 ml of anhydrous DMF (dimethylformamide). Subsequently, succinic anhydride (150 mg, 1.49 mmol) was dissolved in 3 ml of anhydrous DMF, added dropwise to the anhydrous DMF solution containing the previously prepared UCNPs @ Si02-NH2 nanoparticles, and kept stirring at room temperature overnight. The ring opening reaction gave rise to functionalized nanoparticles with carboxylic acid (UCNPs @ Si02-COOH), which were recovered by centrifugation. Traces of DMF solvent were removed by several centrifugation steps with ethane! Finally, the UCNPs @ Si02-COOH nanoparticles dispersed in water. After this process the resulting particles have free surface COOH groups, which can be used to immobilize detection probes.
    Example 4. Synthesis of UCNP @ (poly acrylic acid) nanoparticles The modification of the UCNP with acrylic polyacid (PAA) was carried out by exchanging the original hydrophobic ligands for hydrophilic ligands such as high temperature diethylene glycol PAA. Briefly, an aqueous solution of PAA (3 ml at 1% w / w) was added to a flask containing 30 ml diethylene glycol (SDR). The mixture was heated to 110 ° C to form a clear solution. Next, 100 mg of UCNPs were slowly added as those synthesized in Example 1 dispersed in 20 mL of toluene, keeping the temperature for 1 hour at 110 ° C under nitrogen protection, with recurring vacuum purges in order to remove the Toluene. After this the solution was heated to 240 ° C keeping it at reflux for 4 h. Then, the resulting solution was cooled to room temperature. At that temperature 40 mL of ethanol was added. The mixture was centrifuged to precipitate the UCNP @ PAA, which was recovered and stored in MES buffer (2- (N-morpholino) ethanesulfonic acid), at pH 6. After this process the resulting particles had free surface COOH groups from the PAA , which are likely to be used to immobilize detection probes. Example 5. Synthesis of UCNP @ (azelaic) nanoparticles
    A mixture of 100 mg UCNP, such as those synthesized in Example 1, in 100 mL of hexane, 70 mL of tert-butanol and 10 mL of 5% by weight aqueous K2C03 solution were incorporated. This solution was stirred at room temperature for approximately 20 min.
    Then, 20 ml of Lemieux-von Rudloff reagent (5.7 mM KMn04 and 0.105 M NaI04) were added dropwise. The resulting mixture was stirred at 40 ° C for at least 2 hours. After this, the product was isolated by centrifugation giving rise to a precipitate that was washed with deionized water, acetone and ethanol. After this washing, the product was neutralized and dispersed in an aqueous solution of hydrochloric acid (50 ml) with a pH 4-5 for 30 minutes. Finally, the neutralized product was collected by centrifugation and kept in aqueous MES solution. After this process, the particles had free COOH groups on the surface, from the azelaic acid produced on the surface of the particles, and which are capable of being used to immobilize detection probes.
    Example 6. Synthesis of UCNP @ (phosphonic) nanoparticles
    The modification of the UCNP with 3-carboxy ethylphosphonic acid was carried out through high temperature exchange in diethylene glycol. Briefly, an aqueous solution of 150 mg of 3-carboxy ethylphosphonic acid was added to a flask containing 30 ml of diethylene glycol (OEG). The mixture was heated to 110 ° C to form a clear solution. Next, 100 mg of UCNPs were slowly added, such as those synthesized in Example 1, and dispersed in 20 mL of toluene, keeping the temperature for 1 h at 110 ° C under nitrogen protection, with recurring vacuum purges in order of removing toluene. Subsequently, the solution was heated to 240 ° C, keeping it at reflux for 4 h. After this, the resulting solution was cooled to room temperature. At that temperature 40 mL of ethanol was added. The mixture was centrifuged to precipitate the UCNP @ phosphonic, which were recovered and stored in MES buffer, at pH 6. After this process, the resulting particles had free surface COOH groups, from 3-carboxy ethyl phosphonic, and which are likely to be used to immobilize detection probes.
    Example 7. Binding of a single stranded DNA as a detection probe to UCNPs @ -COOH nanoparticles.
    As a detection probe, single-stranded AON was attached to the surface of the nanoparticles made as described in Examples 3, 4, 5 and 6, by a carbodiimide coupling reaction. This reaction produced a covalent bond between the surface carboxylic group of the UCPNs @ -COOH nanoparticles and the 5 'end amino group of the sequence of the single-chain AON detection probe. Two different detection probes were used: -AON probe used to develop a sensor against Dengue virus type 11: Amino-hexyl-TTTT-GGCTTAATCCGACCTGACTTCTG, characterized by SEO ID NO: 1; which corresponds to the complementary and antiparallel sequence of a microRNA produced by the Dengue virus serotype 2-vsRNA-5 (published in: Hussain, M. and Asgari, S. 2014. PNAS 11 (7) 27462751) And which is characterized by SEO ID NO: 3, to which a 4-thymine tail and an amino-hexyl group have been attached for binding to the UCPNs nanoparticles @ -COOH, -AON probe used to develop a sensor against the immunodeficiency virus Human (HIV): Amino-hexyl-TTTTCAGATCTGGTCTAACCAGAGAGAGA, characterized by SEQ ID NO: 2, which corresponds to the complementary sequence and antiparallel to the HIV1-miR-TAR-5p microRNA, with access number in the miRBase: MIMAT0006016, and published in Ouellet, OL. et al. 2008. Nucleic Acids Research. 36 (7): 2353-2365, and which is characterized by SEQ ID NO: 4, to which a tail of 3 thymine and an amino-hexyl group has been attached for binding to the UCPNs @ -COOH nanoparticles.
    For the coupling reaction, the UCPNs @ -COOH nanoparticles made according to Example 3, 4, 5 or 6 were dispersed in a borate buffered solution (0.001 M) at a concentration of 1.82 mg / ml. 2001J1 of this solution (0.364 mg of nanoparticles) was added to an eppendorf tube for each type of UCPNs @ -COOH and for each of the AON probes and, subsequently, an EOC solution (1-ethyl3) was added to each eppendorf - (3-dimethylaminopropyl) carbodiimide) in borate buffer (20 IJI, 0.3M) and a Sulfo NHS solution (sodium N-hydroxysulfosuccinimide) in borate buffer (40 IJI, 0.3M). After stirring the sample for 5 minutes, each of the single-stranded AON probes in aqueous solution (30 IJI, 220.65 IJM) was added to an eppendorf tube. Stirring reactions were maintained overnight and the nanoparticles functionalized with each of the single-stranded AON probes (UCNPs @ -ssONA) were purified by double centrifugation (16400 rpm, 20 min), and resuspended in a buffer solution. 20 mM MONTH and 100 mM NaCI at pH 6.
    Example 8. Optimization and evaluation of the biosensor based on UCNPs @ -ssDNA and GO nanoparticles. The effect of fluorescence damping induced by GO on the different UCNPs @ -ssONA, synthesized as described in Example 7, was studied to optimize the sensor. First, the concentration of UCNPs @ -ssONA nanoparticles was adjusted to 0.4 mg / ml in one of the experiments, in another of the experiments it was adjusted to 0.1 mg / mL, in another it was adjusted to 0.04 mg / mL and in another 0.01 mg / mL aqueous solution (20 mM HEPES buffer, 100 mM NaCI). Different concentrations of GO, from O to 1 mg / ml (20 mM HEPES buffer, 100 mM NaCl) were prepared and incubated with the nanoparticles at 40 ° C for 1 hour. Before performing the fluorescence measurements, the samples were allowed to cool to room temperature.
    Figure 3 shows the reduction of the normalized fluorescence intensity of UCNPs @ -ssDNA (at three nanoparticle concentrations: 0.4, 0.04 and 0.01 mg / mL) by increasing the concentration of GO (an example is shown type of the results obtained with the nanoparticles of examples 3-6 functionalized as described in example 7). It is clearly seen how the fluorescence intensity was dampened by more than 95% when the concentration of GO reached a value of -O, 3mg / ml, in the three cases analyzed. When the concentration of UCNP @ -ssDNA was 0.04 mg / mL, the amount of GO needed to buffer the signal dropped to 0.2 mg / mL while, for concentrations of 0.01 mg / mL of UCNP @ ssDNA , the amount of graphene oxide needed decreased to 0.05 mg / mL. Higher increases in the GO concentration only caused very small increases in damping. This point is important since by using lower concentrations of particles, the amount of GO needed to induce fluorescence damping is reduced proportionally, which saves the biosensor elements.
    A means to break the attractive TT-TT interactions between the detection probes, both single-stranded DNA in Example 7, and the surface of GO is the hybridization of said single stranded DNA strand with a DNA or RNA chain whose sequence is complementary to that of the biosensor detection probe. In this example, the effectiveness of the UCNPs @ -ssDNA nanoparticles generated in Example 7 to detect a sequence from dengue virus type 11 (CAGAAGUCAGGUCGGAUUAAGCC, sequence characterized by SEO ID NO: 3) and, also, a sequence has been verified from HIV-1 miR-TAR-p5 (UCUCUCUGGUUAGACCAGAUCUGA, characterized by SEO ID NO: 4). The union between each pair of complementary strands induces a conformational change of the DNA strands that prevents adsorption of the UCNPs @ -ssDNA nanoparticles on the GO surface. As a result, UCNPs @ -ssDNA nanoparticles retain their fluorescence.
    Different amounts (0.4; 0.1; 0.04 and 0.01 mg / mL) of UCNPs @ -ssDNA with different concentrations (between 1.10-6 to 1.10-15 M) of the characterized sequence were incubated in HEPES by SEO ID NO: 3 (for nanoparticles functionalized with SEO ID NO: 1), for 2 minutes at 90 ° C and allowed to cool slowly to 40 ° C. The same experiment was performed using nanoparticles functionalized with SEO ID NO: 2 and incubating them with different concentrations of SEO ID NO: 4.
    It is important to note that, as can be seen in Figure 4, as the amount of UCNPs @ -ssONA particles used in the detection was reduced, the system showed a lower detection limit, from 0.1 nM of nucleic acid when 0.4 mg / mL of nanoparticles were used up to 1 fM of nucleic acid when 0.01 mg / mL of UCNPs @ -ssONA were used.
    Example 9. Biosensor specificity based on UCNPs @ -ssDNA and GO nanoparticles. To assess the specificity of the sensor, a control experiment was performed in which three concentrations of UCNPs @ SiOzssONA nanoparticles were compared: 0.4 mg / mL, 0.04 mg / mL and 0.01 mg / mL. In these experiments, 20 mM HEPES, 100 mM NaCl were incubated in the presence of RNA sequences not complementary to the biosensor detection probe, extracted from serum from human isolated samples at concentrations of 1.10-8 M up to 1.10-18 M. An incubation was performed at 90 ° C for 2 minutes, then a solution of GO in 20 mM HEPES, 100 mM NaCI was added to a final concentration of 0.1 mg / ml, and the solution was left at 40 ° C for 1 hour. After incubation, when the solution reached room temperature, the up-conversion fluorescence was measured as described in Example 10. Figure 5 shows how, regardless of the concentration present in the non-nucleic acid sample Complementary to the strand used as a detection probe, characterized in this example by SEO ID NO: 2, the GO dampened the fluorescence of the UCNPs @ -ssONA nanoparticles, demonstrating the specificity of the biosensor of the invention.
    Example 10. Fluorescence measurement The fluorescence of the analyzed samples was measured using a SpectraSuite spectrometer (OceanOptics, USA) coupled to a laser (Armlaser, USA) that works at 980 nm and that illuminates the sample at a 90 ° C angle. with respect to the position of the detector. Said signal was collected, with special emphasis on the fluorescence bands observed at 563
    nm and 654 nm, whose intensity is directly related to the amount of target RNA present in the sample.
    权利要求:
    Claims (59)
    [1]
    one. Biosensor for the detection of nucleic acids comprising: a) a nanoparticulate system that includes a matrix with an acceptor selected from the lanthanide group and a donor selected from the lanthanide group, and a layer with COOH functional groups; b) a detection probe; c) a buffer, understood as such a compound capable of damping the fluorescence of a fluorophore; in which the concentration of the nanoparticulate system, once mixed all the elements that integrate it as well as the sample problem in which it is intended to identify the presence or absence of the nucleic acid for whose detection the biosensor is designed, is 0.01- 0.1 mg / ml aqueous solution.
    [2]
    2. Biosensor according to claim 1 wherein the nanoparticulate system of part a) is constituted by: nanofibers, nanowires, nanollamines, nanoparticles or any other arrangement on a nanometric scale.
    [3]
    3. Biosensor according to any one of claims 1-2 wherein the matrix comprises: NaYF4, CaYF5 and / or CaF2.
    [4]
    Four. Biosensor according to any one of claims 1-3 wherein the donor is selected from the group consisting of: Yb3 +, Gd3 +, Nd3 +, Ce3 +, or combinations thereof.
    [5]
    5. Biosensor according to claim 4 wherein the donor is Yb3 +.
    [6]
    6. Biosensor according to any of the preceding claims wherein the donor concentration is 10 -95 mol% with respect to the total donor and acceptor.
    [7]
    7. Biosensor according to claim 6 wherein the concentration of the donor is 90mol% with respect to the total donor and acceptor.
    [8]
    8. Biosensor according to any of the preceding claims wherein the acceptor is selected from the group consisting of: Tm3 +, Er3 +, Dy3 +, Sm3 +, H03 +, Eu3 +, Tb3 +, Pr3 + or combinations thereof.
    [9]
    9. Biosensor according to claim 8 wherein the acceptor is selected from Er3 +, Tm3 + or combinations of the two.
    [10]
    10. Biosensor according to claim 9 wherein the acceptor is Er3 +.
    [11 ]
    eleven . Biosensor according to any of the preceding claims wherein the concentration of the acceptor is between 5 and 90 mol% with respect to the total donor and acceptor.
    [12]
    12. Biosensor according to claim 11 wherein the concentration of the acceptor is 10 mol% with respect to the total donor and acceptor.
    [13]
    13. Biosensor according to any one of the preceding claims wherein the layer with COOH functional groups is selected from: silicon oxide (Si02), acrylic polyacid (PAA), azelaic acid and / or phosphonic acid derivatives.
    [14]
    14. Biosensor according to any of the preceding claims in which the nanoparticulate system of part a) is selected from the group: NaYF4: Yb, Er @ Si02, NaYF4: Yb, Er @ (acrylic polyacid), NaYF4: Yb, Er @ (azelaic) , NaYF4: Yb, Er @ (phosphonic), NaYF4: Yb, Er @ NaY @ Si02, NaYF4: Yb, Er @ NaY @ (acrylic polyacid), NaYF4: Yb, Er @ NaY @ (azelaic), NaYF4: Yb, Er @ NaY @ (azelaic), NaYF4: Yb, Er @ NaY @ (polyacrylic acid).
    [15]
    fifteen. Biosensor according to any of the preceding claims in which the buffer of section c) is selected from the group: graphene oxide, monolayer or multilayer carbon nanotubes, nanolamines or nanoparticles of carbon nitride, soot, graphite nanoparticles or combinations thereof .
    [16]
    16. Biosensor according to claim 15 wherein the buffer is graphene oxide.
    [17]
    17. Biosensor according to claim 16 wherein the graphene oxide is at a concentration of 0.05-0.3 mg / ml in aqueous solution, once mixed
    all the elements that integrate it as well as the sample problem in which it is intended to identify the presence or absence of the nucleic acid for whose detection the biosensor is designed.
    [18]
    18. Biosensor according to any of the preceding claims wherein the detection probe is selected from the group consisting of: antibodies, peptides, enzymes, cells, DNA, RNA, ALN, APN, their derivatives, cooligomers and combinations thereof.
    [19]
    19. Biosensor according to claim 18 wherein the probe is a nucleic acid.
    [20]
    twenty. Biosensor according to claim 19 wherein the probe is single stranded DNA.
    [21 ]
    twenty-one . Biosensor according to any of the preceding claims in which the concentration of the nanoparticulate system, once all the elements that integrate it as well as the test sample are mixed, is 0.01 mg / ml of aqueous solution.
    [22]
    22 Method for making biosensors as defined in claims 1-21 which includes: a) synthesizing a nanoparticulate system that includes a matrix with an acceptor and a donor; b) coating the nanoparticulate system of step a) with a layer with COOH functional groups; c) functionalize the nanoparticulate system in step b) by joining a detection probe; d) prepare a suspension (A) with the functionalized nanoparticles of step c) in aqueous solution; e) prepare a suspension (B) that includes a buffer capable of damping the fluorescence of a fluorophore in aqueous solution; where the concentration of nanoparticles in the suspension (A) is such that, by mixing the suspension (A) with the suspension (B) and with a test sample in which it is desired to detect the presence or absence of a specific nucleic acid, the concentration Final nanoparticles in the mixture is 0.01-0.1 mg / mL.
    [23]
    2. 3. Method according to claim 22 wherein, in step a), nanofibers, nanowires, nanollamines, nanoparticles or any other arrangement on a nanometric scale are synthesized.
    [24]
    24. Method according to any of claims 22-23 in which the matrix of step a) is synthesized with NaYF4, CaYF5, and / or CaF2.
    [25]
    25. Method according to any of claims 22-24 in which donor is selected from the group: Yb3 +, Gd3 +, Nd3 +, Ce3 +, or combinations thereof.
    [26]
    26. Method according to claim 25 wherein the donor is Yb3 +.
    [27]
    27. Method according to any of claims 22-26 wherein the concentration of the donor in step a) is 10-95 mol% with respect to the total donor and acceptor.
    [28]
    28. Method according to claim 27 wherein the concentration of the donor is 90 mol%.
    [29]
    29. Method according to any of claims 22-28 in which the acceptor is selected from the group consisting of Tm3 +, Er3 +, Dy3 +, Sm3 +, H03 +, Eu3 +, Tb3 + and Pr3 + or combinations thereof.
    [30]
    30 Method according to claim 29 wherein the acceptor is Er3 +, Tm3 + or combinations of the two.
    [31 ]
    31. Method according to any of claims 22-30 in which the concentration of the acceptor is 5 and 90 mol% with respect to the total donor and acceptor.
    [32]
    32 Method according to claim 31 wherein the concentration of the acceptor is 10 mol% with respect to the total donor and acceptor.
    [33]
    33. Method according to any of claims 22-32 in which the material used in step b) is selected from the group consisting of:
    silicon (Si02), acrylic polyacid (PAA), azelaic acid and / or phosphonic acid derivatives.
    [34]
    3. 4. Method according to any of claims 22-33 in which the nanoparticulate system is selected from the group: NaYF4: Yb, Er @ Si02, NaYF4: Yb, Er @ (acrylic polyacid), NaYF4: Yb, Er @ (azelaic), NaYF4 : Yb, Er @ (phosphonic), NaYF4: Yb, Er @ NaY @ Si02, NaYF4: Yb, Er @ NaY @ (acrylic polyacid), NaYF4: Yb, Er @ NaY @ (azelaic), NaYF4: Yb, Er @ NaY @ (azelaic), NaYF4: Yb, Er @ NaY @ (polyacrylic acid).
    [35]
    35 Method according to any of claims 22-34 wherein the detection probe used in step c) is selected from the group consisting of: antibodies, peptides, enzymes, cells, DNA, RNA, ALN, APN, their derivatives, cooligomers and combinations thereof.
    [36]
    36. Method according to claim 35 wherein the detection probe is single stranded DNA.
    [37]
    37. Method according to any of claims 22-36 wherein the suspension buffer (B) is selected from the group: graphene oxide, monolayer or multilayer carbon nanotubes, nanolamines or nanoparticles of carbon nitride, soot, or graphite nanoparticles or combinations thereof.
    [38]
    38. Method according to claim 37 wherein the buffer is graphene oxide.
    [39]
    39. Method according to any of claims 22-38 in which the final concentration of nanoparticles in the mixture is 0.01 mg / ml.
    [40]
    40 Method for detecting a target nucleic acid sequence present in a test sample that includes:
    (1) incubating the test sample with nanoparticulate systems as defined in section a) of claims 1-21 functionalized by joining a detection probe, in aqueous medium, at the appropriate temperature and for the time necessary for it produce the denaturation of the double nucleic acid chains and, subsequently, at the appropriate temperature and for the time necessary for them to hybridize the nanoparticle detection probe and the complementary nucleic acid whose presence / absence is sought in the test sample;
    (2) decrease the temperature of the mixture in step (1) until it reaches room temperature;
    (3) add a buffer as defined in section c) of claims 1-21, in aqueous solution, and incubate at room temperature for at least 10 minutes;
    (4) measure the emitted fluorescence;
    (5) select as positive samples whose fluorescence is at least three times higher than that emitted by a negative control that does not include the target nucleic acid sequence and as negative samples whose fluorescence is equal to less than three times the fluorescence of said negative control ; where the concentration of nanoparticulate systems in step (3) is 0.01-0.1 mg / ml of aqueous solution.
    [41 ]
    41. Method according to claim 40 wherein the test sample is from soil, water, vegetables, food, blood, urine, cerebrospinal fluid, mucous membranes, biopsies, saliva, biological specimens or body fluids and is isolated from the environment, vegetables, animals or of man.
    [42]
    42 Method according to any one of claims 40-41 wherein in step (1) the denaturation temperature is 85-95 ° C and is maintained for 3-10 minutes and the hybridization temperature is 40-45 ° C and It is kept for at least 15 minutes.
    [43]
    43 Method according to any of claims 40-42 wherein the suspension of buffer in aqueous solution of step (3) is such that the final concentration of the buffer is 0.05-0.3 mg / ml.
    [44]
    44. Method according to any of claims 40-43 in which the concentration of nanoparticulate systems in step (3) is 0.01 mg / ml of aqueous solution.
    [45]
    Four. Five. Kit including a biosensor as defined in claims 1-21 together with the reagents and solutions necessary for the detection of nucleic acids.
    [46]
    46. Kit according to claim 45 wherein the nucleic acids have between 15 and 50 nucleotides.
    [47]
    47 Use of the biosensor defined in claims 1-21, of the method defined in claims 40-44 or of the kit defined in the claims
    10 45-46 to detect in vitro infectious or non-infectious diseases, pathogenic microorganisms, genetic alterations, cancer, RNA, DNA, proteins, peptides, antibodies, for prenatal screening.
    [48]
    48. Use according to claim 47 wherein the infectious disease is dengue or AIDS.
    [49]
    49. Use of the biosensor defined in claims 1-21, of the method defined in claims 40-44 or of the kit defined in claims 45-46 to detect animal and / or plant species, allergens and / or proteins
    20 in food.
    Figure 1
     Figure 2
    60x103_¡-_ ~ I ---- ~ I-- ~ --L-I -, - ~ I ------ L-I-- ~ _
     fifty
    -
     40
    ... J
     to. 30
    one-
    IV
    .
     one;,. h ~ ~
    ...., ...............-: ': ......:. J.J.: .. ...: ............/ ......, ..............., ....._...._............
    or l I -J, _ ~ •• ~ '' -.- r------./'''',_~~~~~ __-- ''
    400 500 600 700 800 900
    TO
    Figure 3
    [0]
    0.0 0.2 0.4 0.6 0.8 1.0 GO
     Figure 4
    1.0
    [0]
    0.25
    [0]
    0.8
    [0]
    0.20
    [0]
    0.6
    ... J ... J
    [0]
    0.1 5
    "
    ""
    [0]
    0.4
    [0]
    0.10
    [0]
    0.2
    [0]
    0.05
    RNA (M)
    Figure 5
    ... J
    to..
    or
    类似技术:
    公开号 | 公开日 | 专利标题
    Yin et al.2012|One-step engineering of silver nanoclusters–aptamer assemblies as luminescent labels to target tumor cells
    Stoeva et al.2006|Multiplexed DNA detection with biobarcoded nanoparticle probes
    Doughan et al.2015|A paper-based resonance energy transfer nucleic acid hybridization assay using upconversion nanoparticles as donors and quantum dots as acceptors
    US8642260B2|2014-02-04|Single quantum-dot based aptameric nanosensors
    CN100419426C|2008-09-17|Functionalized nanoparticles and methods of use
    Zhang et al.2013|Robust and specific ratiometric biosensing using a copper-free clicked quantum dot–DNA aptamer sensor
    US9797840B2|2017-10-24|Highly fluorescent polymer nanoparticle
    Amini et al.2017|Fluorescence bio-barcode DNA assay based on gold and magnetic nanoparticles for detection of Exotoxin A gene sequence
    Hu et al.2011|Nucleic acid-functionalized nanomaterials for bioimaging applications
    Zhou et al.2012|A new strategy for the detection of adenosine triphosphate by aptamer/quantum dot biosensor based on chemiluminescence resonance energy transfer
    BRPI0721095B1|2015-09-29|SYSTEMS AND METHODS FOR MULTIPLEX REAL-TIME PCR ANALYSIS
    CN102676508A|2012-09-19|Small molecule probe based on nano-gold and aptamer and preparation method of small molecule probe
    He et al.2013|A highly selective sandwich-type FRET assay for ATP detection based on silica coated photon upconverting nanoparticles and split aptamer
    ES2580138B2|2017-09-11|Biosensor for nucleic acid detection, method of elaboration and use
    Shojaei et al.2016|Fluorometric immunoassay for detecting the plant virus Citrus tristeza using carbon nanoparticles acting as quenchers and antibodies labeled with CdTe quantum dots
    Zhou2012|Quantum dot–nucleic acid/aptamer bioconjugate-based fluorimetric biosensors
    BRPI0712897A2|2012-10-09|method and system for detecting and / or quantifying an analyte in a sample
    US20120088232A1|2012-04-12|Aptamer-Based Device For Detection Of Cancer Markers And Methods Of Use
    Riccò et al.2011|Signal enhancement in DNA microarray using dye doped silica nanoparticles: application to human papilloma virus | detection
    Ray et al.2007|A gold-nanoparticle-based fluorescence resonance energy transfer probe for multiplexed hybridization detection: accurate identification of bio-agents DNA
    Yang et al.2014|A novel fluorescent detection for PDGF-BB based on dsDNA-templated copper nanoparticles
    Zhou et al.2015|A paper-based sandwich format hybridization assay for unlabeled nucleic acid detection using upconversion nanoparticles as energy donors in luminescence resonance energy transfer
    Zarei-Ghobadi et al.2018|A genosensor for detection of HTLV-I based on photoluminescence quenching of fluorescent carbon dots in presence of iron magnetic nanoparticle-capped Au
    Latorre et al.2013|Fluorescent DNA stabilized silver nanoclusters as biosensors
    Brenneman et al.2010|Aptamer-based optical bionano sensor for mercury | ions
    同族专利:
    公开号 | 公开日
    ES2580138B2|2017-09-11|
    引用文献:
    公开号 | 申请日 | 公开日 | 申请人 | 专利标题
    CN104818325A|2015-04-16|2015-08-05|上海大学|Nanoprobe for acute promyelocytic leukemia fluorescence detection and preparing method thereof|CN108786891A|2018-06-25|2018-11-13|肇庆市华师大光电产业研究院|A kind of preparation method of the carbon-based full spectrum composite photo-catalyst of nitridation|
    CN109534889A|2018-10-26|2019-03-29|华南农业大学|A kind of sodium yttrium tetrafluoride nano particle is improving the purposes in plant root/shoot ratio|
    法律状态:
    2017-09-11| FG2A| Definitive protection|Ref document number: 2580138 Country of ref document: ES Kind code of ref document: B2 Effective date: 20170911 |
    优先权:
    申请号 | 申请日 | 专利标题
    ES201600412A|ES2580138B2|2016-05-24|2016-05-24|Biosensor for nucleic acid detection, method of elaboration and use|ES201600412A| ES2580138B2|2016-05-24|2016-05-24|Biosensor for nucleic acid detection, method of elaboration and use|
    [返回顶部]